Skip to content

Neurony dopaminergiczne wytwarzane z funkcji embrionalnych komórek macierzystych małpy w modelu naczelnych Parkinsona ad 7

2 miesiące ago

679 words

Komórki PA6 powleczone na szkiełkach powleczonych kolagenem typu I (BD) lub powleczonych żelatyną (żelatyna z Sigma-Aldrich, płytki z BD) zastosowano jako warstwę komórek odżywczych. Aby uniknąć zakażenia przez przypadkowe różnicowanie komórek, ręcznie wyselekcjonowaliśmy niezróżnicowane kolonie komórek ES o morfologii komórek macierzystych (ciasno upakowane komórki wykazujące wysoki stosunek jądra do cytoplazmy). Niezróżnicowane kolonie komórek ES przemyto dwa razy minimalnym niezbędnym podłożem Glasgow (GMEM) (Sigma-Aldrich) uzupełnionym 10% KSR, mM pirogronianem (Sigma-Aldrich), 0,1. M nieistotnymi aminokwasami i 0,1. MM 2-ME. Po trypsynizacji częściowo zdysocjowane grudki komórek ES (10. 50 komórek na grudkę) wysiano na komórki PA6 przy 1000 skupiskach na 10 cm szalce. Komórki następnie hodowano w GMEM uzupełnionym 5% KSR, 2 mM glutaminy, 0,1 mM aminokwasów nieistotnych, mM pirogronianu i 0,1 mM 2-ME przez 2 tygodnie. Zróżnicowane kolonie odłączono od komórek odżywczych przy użyciu systemu dysocjacji papainy (Worthington Biochemical Corp.). Wyizolowane kolonie hodowano w pożywce neurodasnej (Invitrogen Corp.) uzupełnionej suplementem B27 (Invitrogen Corp.), 20 ng / ml FGF2 i 20 ng / ml EGF (R & D Systems) przez tydzień. W eksperymentach badających wpływ czynników wzrostu na hodowlę neurosfery, wskazane stężenia FGF20 (1pg / ml, 10 pg / ml i ng / ml) dodano do pożywki z FGF2 i EGF lub bez nich. W celu oceny ekspresji neuronalnych markerów komórek progenitorowych przez każdą komórkę, kulki inkubowano z papainą w 37 ° C przez 10 minut, a następnie mechanicznie rozdzielono na pojedyncze komórki. Po inkubacji z inhibitorem papainy zdysocjowane komórki wysiano na szkiełka pokryte OL (OL z Sigma-Aldrich) przy gęstości 105 komórek / cm2. Po 16 godzinach utrwalono je w 4% paraformaldehydzie (Sigma-Aldrich) i oceniono metodą immunofluorescencji. Różnicowanie neuronowych komórek progenitorowych. Kulki izolowano ręcznie i umieszczano na szkiełkach powlekanych OL w pożywce neurozasadowej, do której dodano dodatek B27, 20 ng / ml czynnik neurotroficzny pochodzący z mózgu (Sigma-Aldrich) i 20 ng / ml neurotrofiny-3 (Sigma-Aldrich). . Po tygodniu hodowli, sfery zostały utrwalone lub wykorzystane do dodatkowych eksperymentów. Analiza RT-PCR. Całkowity RNA wyizolowano ze zróżnicowanych komórek przy użyciu zestawu TRIzol (Invitrogen Corp.) zgodnie z instrukcjami producenta. Syntezę cDNA przeprowadzono przy użyciu zestawu SuperScript cDNA Synthesis SuperScript (Invitrogen Corp.). PCR przeprowadzono przy użyciu polimerazy KOD-plus (Toyobo Co.) w następujących warunkach cyklicznych: 30 sekund w 94 ° C, 30 sekund w 60,5 ° C, 60 sekund w 68 ° C × 30 cykli dla Pax2, Ptx3, Nurr1, i GAPDH; i 30 sekund w 94 ° C, 30 sekund w 66 ° C, 60 sekund w 68 ° C x 30 cykli dla Lmx1b i TH w termocyklerze (Astec Co.). Eksperymenty powtórzono 4 do 7 razy dla potwierdzenia, a produkty PCR zsekwencjonowano w celu wykluczenia wyników fałszywie dodatnich. Zastosowane startery są następujące: Pax2, TGTGTCAGCAAAATCCTGGGCAGGT i TGCTGAACTTTGGTCCGGATGAT; Ptx3, TTCGCCTTCAACTCGGTCAACGT i CCCAGGGTCTGAAAGGGGTG; Nurr1, CTCCCAGAGGGAACTGCACTTCG i CTCTGGAGTTAAGAAATCGGAGCTG; Lmx1b, GCAGCGGCTGCATGGAGAAGATCGC i GGTTCTGAAACCAGACCTGGACCAC; TH, GACTGCTGCCACGAGCTGCTGGG i TCTTGGTAGGGCTGCACGG; i GAPDH, GTGAAGGTCGGAGTCAACG i GGTGAAGACGCCAGTGGACTC. Badanie uwalniania dopaminy. Kulki traktowane FGF2 i FGF20 nanoszono na płytki powlekane OL 35 mm z gęstością 50 kulek na szalkę i wykonano w celu rozróżnienia na tydzień. Następnie, po przepłukaniu roztworem o niskim KCI (4,7 mM), komórki inkubowano w ml roztworu o wysokim KCl (20 mM HEPES-NaOH, pH 7,4, 85 mM NaCl, 60 mM KCl, 2,5 mM CaCl2 1,2 mM MgS04, 1,2 mM KH2PO4 i 11 mM glukozy) przez 15 minut. Stężenie dopaminy oznaczono metodą HPLC, stosując kolumnę z odwróconą fazą i elektrochemiczny układ detekcyjny (HTEC 500, Eicom Corp.), jak opisano wcześniej (49). Model zwierzęcy. Dorosłe samce małp cynomolgus (M. fascicularis) ważące 2,5. 3,5 kg otrzymywały dożylnie zastrzyki MPCl HCl (0,4 mg / kg w postaci wolnej zasady, Sigma-Aldrich) dwa razy w tygodniu, aż do utrzymujących się zaburzeń behawioralnych Parkinsona, takich jak drżenie, spowolnienie ruchów i zaburzona równowaga stała się oczywista. Zwierzęta otrzymały średnio 14,7 MPTP zdjęć i wykazywały stabilny parkinsonizm przez około 30 dni. Aby zapobiec jakiejkolwiek możliwości spontanicznego powrotu do zdrowia, do doświadczeń z transplantacją stosowano tylko te małpy, które wykazywały stabilne pogorszenie przez okres dłuższy niż 12 tygodni. Wszystkie zwierzęta karmiono peletkami i świeżymi owocami i miały swobodny dostęp do czystej wody
[przypisy: wrzodziejące zapalenie jelita grubego objawy, crt p, badania elektrofizjologiczne ]
[patrz też: diukowie hazzardu cda, outlet szczecin godziny otwarcia, psychoterapia na czym polega ]